söndag 26 september 2010

The informational problem - telomeres and loops.

Telomeres are end caps of the chromosomes, and essential for their function, stability and prevent gene amplification. Telomeres protect the normal ends of chromosomes from being recognized as deleterious DNA double-strand breaks (shelterin protects the ends). Correct telomere length setting is crucial for long-term survival. The telomere length reserve must be sufficient to avoid premature cellular senescence and the acceleration of age-related disease.

It is currently not understood how telomeres prevent DNA damage responses from causing permanent cell cycle arrest. Telomeres constitute a chromatin-privileged region of the chromosomes that lack essential epigenetic markers for DNA damage response amplification and cell cycle arrest, and checkpoint mediator exclusion in cell division is crucial, otherwise the DNA damage-repair system would initiate a checkpoint response and cause telomere – telomere fusions. Checkpoint kinases modulate chromatin structures near DNA breaks by phosphorylating a serine residue in the carboxy-terminal tail SQE motif of histone. Mutation of the histone genes caused sensitivity to a wide range of genotoxic agents, increased spontaneous DNA damage, and impaired checkpoint maintenance. Also striking synergistic interaction in ionizing radiation (IR) survival.

Most of the eukaryotic telomeric DNA is organized in tightly packed nucleosomes(an octameric core structure of histones with DNA wrapped around)which are separated by 10–20 bp of linker DNA. Several specific proteins contribute to the telomeric structure; however, the exact telomere organization is still unclear. Whereas the role played by telomeric proteins in telomere function and regulation has been widely investigated, little is known about the contribution of nucleosomes to the protection of chromosome ends.

A telomere is a region of repetitive DNA which defer the degradation of genes near the ends of chromosomes by allowing for the shortening of chromosome ends, which necessarily occurs during chromosome replication. Telomere length varies greatly between species, up to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. In general, one strand is rich in G with fewer Cs. These G-rich sequences can form four-stranded structures, G-quadruplexes, with sets of four bases held in plane and then stacked on top of each other with either a sodium or a potassium ion between the planar quadruplexes.

In human blood cells, the range of lengths of the telomeres varies between 8000 base pairs at birth, to 1,500 base pairs in the elderly. During cellular division, an average of 30 to 200 base pairs are removed from the ends of the telomeres. In normal cases, the cells of a human can divide between 50 to 70 times.

Fig. Structure of parallel quadruplexes that can be formed by human telomeric DNA. Telomerase also contains a piece of template RNA, the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In humans, this TERC telomere sequence is a hexameric repeating string of TTAGGG-end in the 3' direction, between 3 and 20 kilobases in length.

Replication, transcription, recombination and damage repair use similar structures.
DNA can adopt structures other than the Watson–Crick duplex when actively participating in replication, transcription, recombination and damage repair. Of particular interest are guanine-rich regions, which can adopt a four-stranded topology called the G-quadruplex. Such architectures are adopted in several key biological contexts, including DNA telomere ends, the purine-rich DNA strands of oncogenic promoter elements, and within RNA 5′-untranslated regions in close proximity to translation start sites.

Alternate DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by sequences that are widely distributed throughout the human genome. G-quadruplexes are built from the stacking of successive G–G–G–G tetrads (G-tetrads) and stabilized by bound monovalent Na+ and K+ cations . The G-tetrad is a cyclic hydrogen-bonded square planar alignment of four guanines, with the guanines adopting either anti or syn alignments about glycosidic bonds. G-quadruplexes are very stable, with their large diameter and four grooves defining a unique architecture different from the double helix.


Schematic pic. The backbone can adopt different directionalities.
a. Each guanine uses its Watson–Crick and major groove edges to form a pair of hydrogen bonds. This leaves the minor groove edge available for further recognition.
b. anti and (c) syn guanine glycosidic torsion angle alignments.
d. Two views of K+ cation-coordination between adjacent G-tetrad planes.


Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence that acts to protect the terminal ends of chromosomes. Telomerase is an unusual DNA polymerase, a reverse transcriptase that extends the single-stranded G-rich 3' protruding ends of chromosomes, stabilizes telomere length in germ line cells (between 1000 and 1700 copies of TTAGGG) and regenerative tissues as well as in tumor cells. When telomerase is present in the cell, its activity is tightly regulated at its site of action by factors specifically bound to the telomeric DNA. Recent data indicate that telomeres reorganize during the cell cycle. In humans, telomerase assembles with telomeres during S phase of the cell cycle.

Telomeres are dynamically organized and remodeled during cell cycle and stress response. This suggests a model in which telomeres switch between extendible and nonextendible states in a length-dependent manner, and a second switch between a non-telomerase-associated "extendible" and a telomerase-associated "extending" state.

The RNA problem.
These TTAGGG tandem repeats are attached to the 3'-ends of the DNA strands and are paired with the complementary sequence 3'-AATCCC-5' on the other DNA strand. Thus, a G-rich region is created at the 3'-end of each DNA strand and a C-rich region is created at the 5'-end of each DNA strand. Typically, at each end of the chromosome, the G-rich strand protrudes 12 to 16 nucleotides beyond its complementary C-rich strand.
The problem of how chromosomes could replicate right to the tip, as such was impossible with replication in a 5' to 3' direction. DNA polymerase can synthesize DNA in only a 5' to 3' direction only by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. DNA polymerase can use a previous stretch of DNA 5' to the RNA template as a template to backfill the sequence where the RNA primer was; at the terminal end of the chromosome, however, DNA polymerase cannot replace the RNA primer because there is no position 5' of the RNA primer where another primer can be placed. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome.


Model of telomere shortening and telomerase activity. Telomerase elongates the 3' ends of chromosomes.

The unique metabolism of G-rich chromosomal regions that potentially form quadruplexes may influence a number of biological processes including immunoglobulin gene rearrangements, promoter activation and telomere maintenance. A number of human diseases are characterized by telomere defects.

Cancers and lifestyle.

If cells divided without telomeres, they would lose the ends of their chromosomes, and the necessary information they contain. The telomeres are disposable buffers blocking the ends of the chromosomes and are consumed during cell division and replenished by an enzyme, the telomerase reverse transcriptase. This may be invoked on with life-style (2008, Dean Ornish - our genes are not our fate (video), they can be changed) et al.. Vitamin D may also slow the shortening of the telomer. Vitamin D is a potent inhibitor of the proinflammatory response. It may also be considered a hormone. We can increase telomerase-levels and switch on good genes or inhibit the telomer-eroding? Telomerase is ubiquitously expressed only during the first weeks of embryogenesis, and is subsequently downregulated (?) in most cell types in humans.
Oxidative stress and accumulating reactive oxygen species (ROS) lead to an increased telomere shortening due to a less efficient repair of SSB in telomeres.

Telomeres can be seen as natural double-strand breaks (DSB), specialized structures which prevent DSB repair and activation of DNA damage checkpoints. Telomerase is the natural enzyme which promotes telomere repair. It is however not active in most cells. It certainly is active though in stem cells, germ cells, hair follicles and (worryingly) in 90 percent of cancer cells. The more a cell divides the more prune to get a cancer. Sometimes a cancer cell is said to be 'degenerated' meaning a more primitive stage - more like a stem cell.

Telomeres act as a sort of time-delay "fuse" or "buffer", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions. Telomeres protect a cell's chromosomes from fusing with each other or rearranging (mutate) — abnormalities that can lead to cancer — and so, cells are destroyed when their telomeres are consumed (apoptosis).

Most cancers are the result of "immortal" (primitive) cells that have ways of evading this programmed death (apoptosis). Malignant cells that bypass this blocked celldivision and become immortalized by telomere extension due mostly to the activation of telomerase, the reverse transcriptase enzyme responsible for synthesis of telomeres. However, 5–10% of human cancers activate the Alternative Lengthening of Telomeres (ALT) pathway (mesenchymal origin), which relies on recombination-mediated elongation. In research they can activate the production of telomerase in cells that do not usually produce this enzyme.

Age and lifestyle.
Short telomeres trigger DNA damage checkpoints, which mediate cellular senescence.
Human somatic cells lacking telomerase gradually lose telomeric sequences, which involves p53 (detoxification, cytochrome-pathway, immunosystem) and pRb pathways (retinoblastoma protein, proliferation, cell cycle, immunoregulation) and leads to the arrest of cell proliferation (regulating progression through the mammalian cell cycle, suppression of emergence of cancer). High levels of the cyclin-dependent kinase inhibitor p16 mediate G1 arrest (and also cdc-proteins) in senescence, by regulation from phosphorylation. Alterations in other cell cycle regulatory genes also mediates senescence. All of these genes encode putative tumor suppressor proteins. Also RAS-cell lines are involved. Fibroblasts are also very important. Developement, tumors and proliferation are invoked on.

However, further cell proliferation can be achieved by inactivation of p53 and pRb pathways = expression of DNA tumor virus oncoproteins. Cells entering proliferation after inactivation of p53 and pRb pathways undergo crisis. Crisis is characterized by gross chromosomal rearrangements and genome instability, and almost all cells die. Rare cells emerge from crisis immortalized = cancerous.

Phosphorylation regulates pRb function and cytochrome function, but also the hormonal situation, inflammation, allergies, diseases of many kinds.
Inhibiting the expression of p53, either by antisense RNA methods or by use of p53 transdominant mutants, leads to a delay in senescence. Many people also have genetically slow function of p53, and are vulnerable to 'bad' lifestyle and medications.

The best way to prevent cancers are to promote the G1 phase of the cell cycle. This is done by a low caloric diet, as instance?

"In 90 percent of cancers, no matter what caused the cancer to form, it needs telomerase activity to maintain the cell. Without telomerase, the cell will die. Telomerase is kept in control by the protein TRF1, which keeps the telomeres operating correctly. TRF1 levels are regulated by ubiquitin-dependent proteolysis. Ubikinon is a growth-regulator that diminish with age.

The adrenal cortex undergoes significant age-related changes at the organ level. With age the zona reticularis disappears and dehydroepiandrosterone (DHEA) and dehydroepiandrosterone sulfate (DHEAS) production decreases and senescence may contribute to it, specifically in the self-renewing stem cell compartment. preservation of the vital functions of the outer zona glomerulosa (= mineralocorticoid production) and zona fasciculata (= glucocorticoid production) may be ensured at the expense of the less vital functions of the innermost zona reticularis (= DHEA production). Senescent cells may also influence the steroidogenic profile through secreted senescence-associated factors. Recent microarray analyses have shown a distinct gene expression profile associated with senescence.

Reactive oxygen species have been implicated in age-associated changes in other steroidogenic tissues, such as Leydig cells and one might speculate that free radicals emerging as intermediate products of the process of steroidogenesis contribute to telomere and DNA damage and, in turn, to aging of the adrenal cortex. Overall, it is an interesting theory that the process started by cellular aging (cellular senescence) spreads via organ aging (loss of zona reticularis) to the organismal endocrine level via ceasing DHEA production.


Phosphorylation of the androgen receptor (AR) by MAPK and AKT. Numerous signalling factors (intracellular and extracellular), involved in inducing cell growth and proliferation, stimulate the Ras pathway to activate MAPK. Subsequently, MAPK phosphorylates AR, enabling AR to form dimers, enhancing ARE (androgen response element) dependent gene expression. Similarly, intra- and extra-cellular factors inducing cell growth and migration and inhibiting cell adhesion activate the PI3 kinase pathway resulting in AKT dependent phosphorylation, dimerisation and activation of AR. Look at the complexity.

New evidence suggests that telomerase activation has an important role in normal somatic cells, and that failure to activate sufficient telomerase also promotes disease. The shortening of telomeres is linked to reduced lifespan, heart disease and osteoarthritis. Telomeres naturally shorten with age as cells divide, but also contract when cells experience oxidative damage linked to metabolism. Such damage is associated with cognitive problems like dementia.
Impairment of telomere integrity causes vascular dysfunction, which is prevented by the activation of telomerase. Mice with short telomeres develop hypertension and exhibit impaired neovascularization. Short telomeres have also been reported in the leukocytes of patients with cardiovascular disease or various cardiovascular risk factors. Also infection from Trypanosoma use epigenetic pathways.

The rate of telomere shortening as cells divide varies between different telomeres. This variation is between 50 to 150 base pairs per cell division. It is worth noting that the telomeres that are shorter initially. For example in humans the 17p telomere, are not necessarily the ones to be destroyed first!

Despite all of the above outlined observations, it is a statement of fact that the mean telomere length of a species does not always relate to the longevity of that species. Of all studied primates, humans seem to have both the shortest telomeres and the longest lifespan!

So, this effect is not genetic?


Schematic fig. for DNA damage response at dysfunctional telomeres. Shelterin subunits protect telomeres.

Epigenesis and environment.
There is a huge reason for the intron to exist and for splicing to occur. DNA damage response can be considered a signaling transduction pathway where the DNA damage is detected by ‘sensors’. Recent studies have demonstrated that epigenetic modifications at telomeres have a profound effect on telomere length, and may also be linked to the ALT mechanism.
Telomeres are mainly formed by the entanglement of repeat DNA and telomeric and non-telomeric proteins, and are mainly seen as a 'mitotic clock'. Telomere lengths are heterogeneous because they differ among tissues, cells, and chromosome arms. Cell proliferation capacity, cellular environment, and epigenetic factors are some elements that affect this telomere heterogeneity. Also, genetic and environmental factors modulate the difference in telomere lengths between individuals. The understanding of telomere length dynamic in the normal population is essential to develop a deeper insight into the role of telomere function in pathological settings.
Chromatin modifications implicated in transcriptional regulation are thought to be the result of a code on the histone proteins (histone code). This code, involving phosphorylation, acetylation, methylation, ubiquitylation, and sumoylation of histones, is believed to regulate chromatin accessibility either by disrupting chromatin contacts or by recruiting non-histone proteins to chromatin. The histone code in which distinct histone tail-protein interactions promote engagement may be the deciding factor for choosing specific DSB repair pathways.

For example, cytosine methylation, a broad variety of histone post-translational modifications, and binding of non-coding RNAs determine the status of chromatin. A code that can be read by chromatin associating complexes, histones, determine the recruitment of effectors that regulate a specific biological process.

The histone code hypothesis.
Histone modifications are critical for the higher order organization of the DNA. The language of covalent histone modifications that correlate with transcription regulation was proposed and defined as the histone code in 2000 (Strahl & Allis, 2000; Turner, 2000).

1.Histone phosphorylation
by kinases has been associated with transcriptional regulation, DNA repair, and chromatin condensation, and has been shown by different laboratories to be linked to the ability of the cells to sense, respond, and repair (=recruiting repair proteins) lesions in DNA . Aurora kinases and mitogen and stress activated kinases have been shown to be responsible for phosphorylation of serine (compaction of chromatin during mitosis ).
Chiral proteins are important for the phospholylation. Chromatin structure needs to return to the original state and the DNA damage response signal to be turned off once the DNA break has been repaired. Phosphatases are required for the removal of ionizing radiation (IR) induced foci and for efficient recovery from DNA damage.

2.
Histone phosphorylation is followed or accompanied by acetylation of the histone residues for evacuation of histone variants from the damage site. The major purpose of acetylation is to induce decondensation of chromatin. Acetylation neutralizes the positive charge of lysine residues decreasing their interaction with negatively charged DNA. Overall, acetylation of lysine residues on histones is associated with transcriptional activation and DNA repair and has to be followed by deacetylation, allows the acquisition of a closed chromatin state.

3. Methylation
of lysine residues has been linked to the detection and repair of DNA DSBs. Dimethylated histone has a conserved role in the recruitment of factors participating in the repair of DNA damage. Trimethylation occur in thymus tissue upon whole-body exposure to irradiation. Impact on telomere metabolism?
As yet, it is not clear whether methylation of histones affects the overall charge of the nucleosomes like acetylation, but methylation of histones does provide sites for binding of chromatin-associating activities. Thus, it seems that such modifications may have a role. Recent studies have shown that DNA damage influences the chromatin associated movement of a non-histone chromatin modifying factor.

4. Ubiquitylation and sumoylation.
Ubiquitin and SUMO are bulky signaling modules that are expected to induce dramatic changes in the structure of chromatin. Histones are the most abundant ubiquitylated proteins that are not targeted for degradation as are other ubiquitylated proteins. In fact, ubiquitylation of histones plays a key role in transcriptional activation and repression, heterochromatic silencing, and DNA repair. SUMO is a small ubiquitin-related molecule of approximately 100 amino acids that modifies proteins. Histone sumoylation has been shown to mediate gene silencing in mammalian cells.

Epigenetic silencing of telomerase and a non-alkylating agent as a novel therapeutic approach talk of therapeutics that inhibits DNA methyltransferase and subsequently induces the expression of genes silenced by methylation, used against gliomas.


Loops, loops everywhere.
Loops in G-quadruplexes are linkers connecting G-rich tracts that support the stacked G-tetrad core. The loops can be classified into four major families that depend in part on the size and sequence of the linkers; lateral, diagonal, double-chain propeller (gives pentos or hexos) and V-shaped loops. Loop conformations stabilize and can adopt diverse topologies making them attractive targets for small molecule-based ligand recognition. The G-quadruplex topology is defined by four grooves whose dimensions (depth and width) and accessibility vary based on both the overall topology and whether the loops are edge-wise or diagonal on one hand, and double-chain-reversal on the other. Cations in the center (prefer K+ over Na+) neutralize the strong electrostatic potential associated with the inwardly pointing guanine O6 oxygen.
No folding rules - each new guanine-rich telomeric and oncogenic promoter must be researced for structure - conformational heterogeneity.

The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle stabilized by telomere-binding proteins. At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop. ALT cells produce abundant t-circles, possible products of intratelomeric recombination and t-loop resolution.

What is the functions of these loops? Strong electromagnetism included? They are sensitive to radiation. Studies have demonstrated the ability of the CTG/CAG and CGG/CCG tracts to form thermodynamically stable self-complementary hairpin structures and tetraplexes. Hairpins assembled from CTG oligomers form very stable antiparallel duplexes with TT pairs, whereas CAG oligonucleotides produce much less stable conformations which are destabilized by AA mispairs. This gives rise to unequal structural properties of repeated DNA during processes where single-stranded regions are involved, i.e., replication, transcription, repair or recombination. Hairpin structures will be formed and maintained more easily on the CTG strand than loops created on a strand containing CAG repeats.

Loops are seen also richly in the Y-chromosome (palindromic, the most prominent features here are eight massive palindromes, at least six of which contain testis genes.) and in the DNA polymerase signal recognition particle (SRP) is a ribonucleoprotein (protein-RNA complex), small RNA - much loops, important for the methionine, startcodon in the proteinsynthesis. Bacterias, plasmids and virus have often also many hairpin loops in their tRNA and HIV may be an example of that. An interesting question is whether the organization of the genome to chromosomes could have some deeper organizational meaning.

Introns are important for RNAs but most eukaryotic RNAs are processed after transcription. These processes include capping, polyadenylation, splicing, CCA turnover on the 3′ end of tRNAs, modification of base, sugar or phosphate moieties, etc.

In the case of human small RNAs it is known that several nucleotides are removed from the 3′ end of the primary transcript to generate mature RNA molecules, or a single adenylic acid residue is added; this nclude human SRP RNA. The signal recognition particle plays an important role in translocation of membrane proteins and secretory proteins. Human SRP RNA is transcribed by RNA polymerase III, and the 5′ and 3′ end portions of SRP RNA are over 80% homologous to the highly repeated Alu sequences in the primate genomes (evolutionary conserved).

The SRP consists of two distinct functional domains. The first one is the Alu domain that has a tRNA-like structure and plays an important role in arresting the elongation of nascent peptide in the ribosome.


A secondary structure of SRP RNA. Mammalian SRP RNA is 300-nucleotide-long, with sequence ex. (5′-pGATCTGATAGTGTCACCTAAATGAATTCA*-3′)
The second functional domain consists of the SRP RNA-specific S fragment and four SRP proteins. This domain is responsible for targeting the ribosome-nascent peptide chain complex to the surface of rough endoplasmic reticulum by interacting with SRP receptor. That is, very central for the synthesis.


The classical function of SRP in translation-translocation. A membrane separates the cytosol from the endoplasmic reticulum. A ribosome (light gray with A, P, and E sites) synthesizes a protein with a signal peptide (green) encoded by messenger RNA (indicated by a line with 5'- and 3-ends). The elongated SRP (blue), with its large (LD) and small (SD) domains, forms a complex which the membrane-resident SRP receptor (SR). When SRP separates, the protein crosses the membrane through a channel or translocon. The signal peptide may be removed by signal peptide peptidase (SP) and the protein modified by oligosaccharyl transferase (OT).


S-domain of human SPR. One or more SRP proteins bind to the SRP RNA to assemble the functional SRP.


Promoter gene.

Guanine-rich DNA sequences can form G-quadruplexes stabilized by stacked G-G-G-G tetrads in monovalent cation-containing solution. The length and number of individual G-tracts and the length and sequence context of linker residues define the diverse topologies adopted by G-quadruplexes. Unanticipated scaffolds such as interlocked G-quadruplexes, as well as novel topologies represented by double-chain-reversal and V-shaped loops, triads, mixed tetrads, adenine-mediated pentads and hexads and snap-back G-tetrad alignments common for oncogenic promoters and telomers, as well as a bimolecular G-quadruplex that targets HIV-1 integrase. Recent identification of guanine-rich sequences positioned adjacent to translation start sites in 5'-untranslated regions of RNA oncogenic sequences. The activity of the enzyme telomerase, which maintains telomere length, can be negatively regulated through G-quadruplex formation at telomeric endsthe energy concept,the ATP, role of the phosphate.

To be continued.

måndag 20 september 2010

Quantum biology - coherence I.

How can we overcome the decoherence problem when matter meets surroundings? This is the question that has stopped high temp. superconduction. Now it may be solved. Universal Dynamical Decoupling of a Single Solid-State Spin from a Spin Bath, by G. de Lange in Science today, may have an answer to the problem, reported by ScienceDaily.

By applying a specially designed sequence of high-precision electromagnetic pulses, the scientists were able to protect the arbitrary quantum state of a single spin, and they made the spin evolve as if it was completely decoupled from the outside world. In this way, scientists achieved a 25-fold increase in the lifetime of the quantum spin state at room temperature. This is the first demonstration of a universal dynamical decoupling realized on a single solid state quantum spin.


The researchers developed and implemented a special kind of quantum control over a single quantum magnetic moment (spin) of an atomic-sized impurity in diamond. These impurities, called nitrogen-vacancy (or N-V) centers, have attracted much attention due to their unusual magnetic and optical properties.

DOE/Ames Laboratory "Implementing dynamical decoupling on a single quantum spin in solid state at room temperature has been an appealing but distant goal for quite a while," said Viatcheslav Dobrovitski.

"Uncontrolled interactions of the spins with the environment have been the major hurdle for implementing quantum technologies. Our results demonstrate that this hurdle can be overcome by advanced control of the spin itself," said Ronald Hanson from Kavli Institute of Nanoscience at Delft.

Besides its importance to fundamental understanding of quantum mechanics, the team's achievement opens a way to using the impurity centers in diamond as highly sensitive nanoscale magnetic sensors, and potentially, as qubits for larger-scale quantum information processing.

Earlier have optical techniques been used. An electron spin localized in a quantum dot is the quantum bit. The spin replaces a classical digital bit, which can take on two values, usually labeled 0 and 1. The electron spin can also take on two values. However, since it is a quantum object, it can also take all values in between. Obviously, such a quantum unit can hold much more information than a classical one. That is why, scientists around the world are trying to find an efficient way to control and manipulate the electron spin in a quantum dot in order to enable new quantum devises using magnetic and electric fields. The electron spin precession frequencies in an external magnetic field are different from each other due to small variations of the quantum dot shape and size. In addition, the electron spin precession frequency has a contribution of a random hyperfine field of the nuclear spins in the quantum dot volume. This makes a coherent control and manipulation of electron spins in an ensemble of quantum dots 'impossible'.

In a Science publication (Science, vol. 313, 341 (2006)),was demonstrated a method, whereby a tailored periodic illumination with a pulsed laser can drive a large fraction of electron spins (up to 30%) in an ensemble of quantum dots into a synchronized motion. almost the whole ensemble of electron spins (90%) precesses coherently under periodic resonant excitation. It turns out that the nuclear contribution to the electron spin precession acts constructively by focusing the electron spin precession in different quantum dots to a few precession modes controlled by the laser excitation protocol, instead of acting as a random perturbation of electron spins, as it was thought previously.

In optical entanglement experiments, a pair of entangled photons may be separated via a beam splitter. Despite their physical separation, the entangled photons continue to act as a single quantum object. They uses electrons in a superconductor in place of photons in an optical system. The electrons they conduct entangle to form what are known as Cooper pairs. In the new experiment, Cooper pairs flow through a superconducting bridge until they reach a carbon nanotube that acts as the electronic equivalent of a beam splitter. Occasionally, the electrons part ways and are directed to separate quantum dots - but remain entangled.

Quantum networks use entangled qubits. Solid-state quantum bits, or "qubits," can communicate with one another over long distances. This would require the nodes that process and store quantum data in qubits to be connected to one another by entanglement, also at long distance.

"Demonstration of quantum entanglement between a solid-state material and photons is an important advance toward linking qubits together into a quantum network."

One can engineer and control the interaction between individual photons and matter in a solid-state material, and the photons can be imprinted with the information stored in a qubit. Builds upon earlier work by Lukin's group to use single atom impurities in diamonds as qubits. Lukin and colleagues have previously shown that these impurities can be controlled by focusing laser light on a diamond lattice flaw where nitrogen replaces an atom of carbon. That previous work showed that the so-called spin degrees of freedom of these impurities make excellent quantum memory.

Lukin and his co-authors now say that these impurities are also remarkable because, when excited with a sequence of finely tuned microwave and laser pulses, they can emit photons one at a time, such that photons are entangled with quantum memory. Such a stream of single photons can be used for secure transmission of information.

"Since photons are the fastest carriers of quantum information, and spin memory can robustly store quantum information for relatively long periods of time, entangled spin-photon pairs are ideal for the realization of quantum networks," Lukin says. "Such a network, a quantum analog to the conventional internet, could allow for absolutely secure communication over long distances."

Rådmark, oct -09, and his team proved experimentally that their six photon qubits are robust and should be able to reliably carry information over long distances.


A new method for combining six photons together results in a highly robust qubit capable of transporting quantum information over long distances.


Driving a qubit along a longer quantum path (routes 2 and 3) dramatically improves the signal quality over that achieved by following the shorter path (route 1). The research applies to information stored in qubits that consisted of Nitrogen-based defects in diamond, as schematically shown on the right.

In most arrangements that rely on Nitrogen atoms in diamond to store data, reading the information also resets the qubit, which means there is only one opportunity to measure the state of the qubit. By developing a technique that involves the spin of the Nitrogen nucleus in the process as well, a team of physicists at the University of Stuttgart in Germany has turned the single step read-out into a multi-step process.

Rather than simply resetting the electron-based qubit when the information is read, the researchers discovered that they can force the state of the Nitrogen nucleus to change state twice before the information in the qubit is finally erased.

A quantum network – in which memory devices that store quantum states are interconnected with quantum information processing devices – is a prototype for designing a quantum internet. The atomic-ensemble memory can receive an arbitrary polarization state of an incoming photon, called a polarization qubit, announce successful storage of the qubit, and later regenerate another photon with the same polarization state.

So now maybe quantum biology also has come a step closer? Synergy and coherence are cornerstones. Earlier we saw that DNA can be made to act as 'transistors' for this world web of information. Is that the essence of the quantum antenna?

lördag 18 september 2010

Walking molecules.

Molecular machines makes up for most of biology. They are proton pumps, electrons, resonances, nervepulses etc. Nanomolecules (nanometre-scale chemical species, nanoparticles) comes by force, as instance as carriers of medicine. "We want synthetic molecules that can move around, carry cargo, act as chemical factories...and above all to make these processes modular, to make them engineerable, says Paul Rothermund, expert in molecular robotics. Today and in future researchers would like having them to walk in a set direction while performing a meaningful task instead of aimless and slowly as by now.

The next step might be to create an autonomous assembly line, just like in biology where independent factories, or "ribosomes", produce different proteins according to the chemical messages. But also the decay chain must be created? Nanoparticles free in nature may be dangerous.

"Eventually we want to make something as complex as a cell that can have all these independent little factories running in it, each one cranking out a different product based on their program – and this is what Seeman's paper is starting to show us how to do," says Rothermund.

Self-assembly can combine and build up assemblies efficiently, but may be subject to thermodynamic and kinetic limitations: reactants, intermediates and products may collide with each other throughout the assembly time course to produce non-target species instead of target species. An alternative approach to nanoscale assembly uses information-containing molecules such as DNA to control interactions and thereby minimize unwanted cross-talk between different components. Maybe Nature itself had come to the same solution? We can build an car on an assembly line? (This is an often used claim in religious debates - it isn't possible. So they are wrong.)

Two Nature articles (1,2) from may this year.

New insights and breakthroughs:
1. Nanorobots: DNA robots mimic the protein motors in our bodies – be it walking without help along predefined routes or taking cargo from A to B. This combine advances in our knowledge of DNA structure and dynamics, suggest that nanorobots could soon be performing autonomous, useful tasks.



1.a. DNA walkers, have a body and feet made from DNA, with extra "anchor" strands of DNA that join the feet to a surface. When different "fuel" strands are put in front of a walker, they preferentially join to the anchor strands, thereby freeing the walker to move forward. Milan Stojanovic. The spider moving forwards in a straight line leaving a trail of cleaved DNA (or cut grass) behind. "An observer, looking at it, could legitimately say that the molecule 'behaves' in a certain way, although in reality the spider just implements simple leg residency rules." The process is fully autonomous.
1.b. Molecular spider, has a protein body and DNA legs that chemically cleave tall strands of DNA on a surface. Simply put, a molecular spider nibbles its way through a lawn of DNA, only going where there is more grass to mow. Ned Seeman, a passing walker can take on eight (that is, 2^3) possible loads and deposit them at the end of the track. The walker, the three independently programmed addition stations and the cargo are all sitting on a DNA origami platform. It is the first assembly line built on the nanometre scale.

Solution: "DNA origami". Based on folded DNA, can be realized by the judicious combination of three known DNA-based modules; makes something akin to a pegboard to which all sorts of molecules can be attached. Folding DNA to create nanoscale shapes and patterns. Paul W. K. Rothemund.

The informational problem.
Robots have to store lots of information in order to coordinate their actions, but how can this be done for nanometre-scale robots? One answer is to program data into the robots' environment instead. Traditional robots rely for their function on computing, to store internal representations of their goals and environment and to coordinate sensing and any actuation of components required in response. Moving robotics to the single-molecule level is possible in principle, but requires facing the limited ability of individual molecules to store complex information and programs. One strategy to overcome this problem is to use systems that can obtain complex behaviour from the interaction of simple robots with their environment.

“Carbon nanotubes will be one of the major future building blocks of molecular electronics due to their small dimensions and excellent electronic properties,” said Braun. “However, you cannot self-assemble a circuit directly with nanotubes because they lack recognition. Science 302 1380

When origami templates and DNA-functionalized nanotubes are mixed, strand displacement-mediated deprotection and binding aligns the nanotubes into cross-junctions. Of several cross-junctions synthesized by this method, one demonstrated stable field-effect transistor-like behaviour. In such organizations of electronic components, DNA origami serves as a programmable nanobreadboard; thus, DNA origami may allow the rapid prototyping of complex nanotube-based structures.

DNA and superconduction.
DNA molecules act as ohmic conductors above 1 K and below this temperature they can superconduct (A Y Kasumov et al 2001 Science 291 280). Carbon nanotubes rolled up sheets of graphite atoms lose their resistance when connected to superconductors. Now Kasumov has shown that this is also true for DNA by connecting double-stranded DNA molecules to rhenium and carbon superconducting electrodes 0.5 µm apart. By cooling the electrodes to below their superconducting transition temperatures, the researchers observed so-called 'proximity induced' superconductivity in the DNA.

Optical experiments have shown that a transfer of charge may be possible in such molecules. But the message from transport measurements has been mixed: some have indicated that DNA could be a conductor while others suggested that DNA is an insulator. Kasumov and colleagues have found that above 1 K, the resistance per molecule is less than 100 kilo-ohm, a figure that varies weakly with temperature and is an order of magnitude lower than previous measurements. Even at very low temperatures, the researchers found that DNA molecules can conduct ohmically over distances of a few hundred nanometres.

Pi-stacks have been shown to conduct charge. Stacking in supramolecular chemistry refers to a stacked arrangement of often aromatic molecules, which is adopted due to interatomic interactions. The most common example of a stacked system is found for consecutive base pairs in DNA. Stacking also frequently occurs in proteins where two relatively non-polar rings overlap. Stacking is often referred to as π-π interaction, though effects due to the presence of a π-orbital are only one source of such interactions, and in many common cases appear not to be the dominant contributors. an aromatic interaction (or π-π interaction) is a noncovalent interaction between organic compounds containing aromatic moieties. π-π interactions are caused by intermolecular overlapping of p-orbitals in π-conjugated systems, so they become stronger as the number of π-electrons increases. Other noncovalent interactions include hydrogen bonds, van der Waals forces, charge-transfer interactions, and dipole-dipole interactions. In DNA, pi stacking occurs between adjacent nucleotides and adds to the stability of the molecular structure. The nitrogenous bases of the nucleotides are made from either purine or pyrimidine rings, consisting of aromatic rings. Within the DNA molecule, the aromatic rings are positioned nearly perpendicular to the length of the DNA strands. Thus, the faces of the aromatic rings are arranged parallel to each other, allowing the bases to participate in aromatic interactions. The bases in the middle of the double helix stack in a way reminiscent of graphite – which is an excellent conductor. Through aromatic interactions, the pi bonds, extending from atoms participating in double bonds, overlap with pi bonds of adjacent bases. This is a type of non-covalent chemical bond. Though a non-covalent bond is weaker than a covalent bond, the sum of all pi stacking interactions within the double-stranded DNA molecule creates a large net stabilizing energy.

Also the DNA backbone – the long strands that support the bases and give DNA its structure – rather than the bases, might support conduction because of its periodic structure. Conduction in terms base stacking have yielded conflicting results. Alternative or complementary conduction mechanisms – such as Brillouin’s backbone conduction – have been largely ignored ( (Phys. Rev Lett. 99 228102 ). Electrons in the backbone delocalize in less than one femtosecond (10-15) in wet DNA. These results imply that electron movement occurs a thousand times faster in the DNA backbone than in the bases stacked in the core. Focusing on the interplay between electron transport through the backbone and the stacked bases could be crucial to understanding DNA conduction.

A better understanding of the role that conduction plays in how living cells detect and repair damaged DNA and could ultimately lead to strands of DNA being used in “molecular electronics” technologies of the future. Conduction is thought to be an important mechanism by which enzymes recognize damaged DNA. Conduction through DNA could protect the genomes of some organisms by transmitting the damage caused by oxidizing chemicals to certain locations on chromosomes where the damage causes the least harm. This is the mitogenic signal for negative energy pray?

It is possible that the contacts act as strong dopants of electrons or holes. Conductivity measurements could in turn help biologists to look for particular sequences of base pairs within DNA molecules.


Without carbon - no Life.

Carbon is a composite boson and essential to Life. Graphene, for example, possesses very uncommon electronic structure and a high carrier mobility, with charge carriers of zero mass moving at constant velocity, just like photons. Future prospects, difficulties and challenges with graphene include growth, morphology, atomic and electronic structure, transport properties, superconductivity, doping, nanochemistry using hydrogen, chemical and bio-sensors, and bio-imaging etc.

Also single sheets of graphane, that is graphene functionalized upon hydrogen, are investigated. At full H-coverage nearly free electron states (NFESs) appear near the conduction band minimum in all the systems under study. At the same time, the electron affinity is strongly reduced becoming negative for the hydrogenated diamond surfaces, and almost zero in graphane. The effects of quasi-particle corrections on the electron affinity and on the NFESs are discussed.

Carbon has the biggest numbers of isomeric states, eight in total.


Magnetism, time and temperature.

The magnetization direction can become unstable due to thermal fluctuations. Then, the magnetization fluctuates randomly between two stable directions. This phenomenon is called superparamagnetism. It constitutes one of the greatest limit to the increase of magnetic memories storage density. Memory needs time.


Energy level diagram describing the stabilization of the ferromagnetic spin arrangement as a result of the interaction between two hybrid orbitals located on two impurities, here labeled TM1 and TM2, in a tetrahedral semiconductor.

Two proactive cultures of predictive theories have emerged:
A. The initial basic philosophy was to use model Hamiltonians, in which certain specific magnetic interactions between ions are postulated (and others are excluded). For this technique, the “user” needs to guess at the outset the type of magnetic interactions that will dominate. This style of model-Hamiltonian theory has had a glorious past in numerous areas of condensed matter physics. It was assumed it was similar to the interaction of nuclear spins mediated by the conduction electrons in metals, and the model also assumes that the host crystal is largely unperturbed by the presence of the 3d impurity ion, and also predict ferromagnetism in various 3d impurity-doped compound semiconductors, among all the prediction that ferromagnetism persists to a high Curie temperature with TC’s well above room temperature in various wide-gap oxides and nitrides.

In a ferromagnet there is an imbalance in the occupancy of spin-up and spin-down states; such a collective spin alignment leads to a macroscopic spontaneous magnetization that persists up to a Curie temperature TC. Many common ferromagnets (such as iron or nickel) are metals, exhibiting a set amount of free electrons that make them conduct electrically. In semiconductors, on the other hand, the concentration and type of electronic carriers is controllable externally, for instance, by doping with select atom types or directly by injecting carriers. Most semiconductors are not magnetic. A material that exhibits both ferromagnetic and semiconductor properties offers the exciting prospect of combining nonvolatile magnetic storage and conventional semiconductor electronics in a single device. Magnetic semiconductors offer a number of interesting possibilities in the pursuit of “spintronics,”a branch of science and technology that exploits the spin dimension of the electron in addition to its charge, for novel electronic devices. These materials combine the properties of a semiconductor and a magnetic material, providing, for instance, a way to create 100% spin-polarized currents, and by the same token, the promise of electrical control of magnetic effects.

Nonmagnetic semiconductor host materials can be doped by a small amount of magnetic transition-metal ions or by defects that promote magnetism (“dilute magnets”). When doped with manganese, Mn2+ substitute for Ga3+ ions, thus releasing “holes” (a positive charge resulting from the absence of an electron) that are said to collectively align the Mn2+ spins ferromagnetically when the sample is cooled below TC.

The description of the superparamagnetic phenomenon has been for a long time simplified by averaging the atomic moments in the particle so that any internal degree of freedom and excitations are then neglected in old model. We have developed a new model, which restores all the internal degree of freedom, using an atomic description and including specifically the temperature. This model has shown that spin-wave eigenmodes can be excited by the temperature and induce an increase of the superparamagnetic fluctuations in the magnetic nanoparticles.

B. First-principles calculations have rapidly penetrated this field. The philosophy here is to describe each host and impurity system by considering its fundamental electronic structure, thereby obtaining the magnetic interaction type as the answer, not the question. Instead of prejudging the preferred type of magnetic interactions between ions, one articulates fundamental electron-ion and electron-electron interactions and lets the magnetic interactions emerge as solutions to the fundamental many-electron Hamiltonian. The availability of density-functional approximations (exchange and correlation functionals for the inter-electronic interactions), accurate pseudopotentials (simplifying the calculation greatly), and the ubiquitous computer packages encoding such developments into friendly interfaces freed the theorist from having to guess at the outset how a particular impurity would affect a particular host crystal.

Nuclear spin and electron spin make the magnetic pattern necessary for chemical movement and energy movement. Impurities direct and strengthen, as GABA inhibits and glutamat strengthen. Impurities are as necessary as noise are in biology.


Fractality and bond entanglements.
Fractal patterns are ubiquitous in nature from the shape of a galaxy to the structure of an atom/particle. They may also lie behind the mysterious phenomenon of high-temperature superconductivity; high-temperature superconductors do not appear to create the pairs of electrons needed for zero-resistance conductivity via vibrations of the crystal lattice. suggested that high-temperature superconductivity may be linked to the distribution of oxygen ions in the layers between the copper oxide. They say it might be the formation of some of these ions into rows, or "stripes", that is responsible.

What they found was that this intensity followed a power-law distribution, in other words that the superconductor was made up of a small number of very high-ordered regions and larger numbers of disordered regions. This, they say, is the hallmark of a scale-free distribution, which is typical of a fractal pattern – with the oxygen stripes forming a similar structure on all scales up to 400 µm.

Partial density of states in the empty conduction band of the phosphate backbone sites in DNA?
Role of the γ-phosphate of ATP in triggering protein folding?
Well-matched duplex DNA in the gap between the electrodes exhibits a resistance on the order of 1 MOmega. A single GT or CA mismatch in a DNA 15-mer increases the resistance of the duplex approx300-fold relative to a well-matched one. Certain DNA sequences oriented within this gap are substrates for Alu I, a blunt end restriction enzyme. This enzyme cuts the DNA and eliminates the conductive path, supporting the supposition that the DNA is in its native conformation when bridging the ends of the single-walled carbon nanotubes.

Structural and functional analysis of condensed DNA Nucleosome core particles self organise into multiple crystalline or liquid crystalline phases. Nucleosome stack on top of each other to form columns. These columns further organise into multiple crystalline or liquid crystalline phases. A lamello-columnar and an inverse hexagonal phase form under low salt conditions. A 2D hexagonal and a 3 D orthorhombic phase are found at higher salt concentrations.


Focal series of a nuclei of the columnar hexagonal phase (a-c) showing how the six branches coil around each other to form a left-handed helix, as indicated on the drawing, on the right (Livolant et Leforestier, 2000 .


Inverted hexagonal phase


DNA in aqueous solution forms liquid crystalline phases, whose nature depends on the DNA and monovalent ion concentrations. A few years ago, we showed that 50 nm DNA fragments (146 bp) form liquid cryalline phases (blue phases, cholesteric phase, hexagonal phase) or 3D crystals (Livolant et al, 1989; Durand et al, 1991, Livolant et Leforestier, 1996).


Walking molecules and oxygen.

Molecular machines could be capable of quantum mechanical tunnelling - normally seen in very tiny particles like electrons and atoms. The tunnelling behaviour has never before been seen in devices so big and is a fundamental departure from mechanics in the macroscopic world, says Ludwig Bartels. It also means that such machines could move much faster than expected.
Bartels and colleagues found that anthraquinone could walk across copper surfaces in a straight line. This was an important result in itself because normal molecules tend to move around randomly in all directions. Moreover, anthraquinone can attach carbon dioxide molecules to its two oxygen atoms, or "legs", and drag this cargo along too while it walks. However, the molecule moved so fast.

Pentacenetetrone has not two oxygen "legs" as in anthraquinone but four. To their surprise, Bartels & co found that this "quadrupedal" molecule, which moves like a pacing horse (both legs on one side of the molecule move together followed next by the two legs on the other side), moved a million times slower than "bipedal" anthraquinone. One foot can just start tunnelling forward at any time and make a successful step.

Portions of the bipedal anthraquinone simply tunnel through barriers (like surface roughness or corrugations) in the environment rather than climbing over them. Although the quadrupedal molecule can coordinate its four "hooves" so that it paces forward, it cannot coordinate both legs so that they tunnel through a surface barrier at the same time. This means that the molecule needs to move its oxygen legs in the conventional way – over the barriers.

Quantum mechanics allows such behaviour for very light particles, like electrons and hydrogen atoms but could it also be relevant for big molecules like anthraquinone?

Molecule Diffusion through Tunneling versus Pacing.

The diffusion temperature of molecular ‘walkers’, molecules that are capable of moving unidirectionally across a substrate violating its symmetry, can be tuned over a wide range utilizing extension of their aromatic backbone, insertion of a second set of substrate linkers (converting bipedal into quadrupedal species), and substitution on the ring. Density functional theory simulation of the molecular dynamics identifies the motion of the quadrupedal species (through electric structure of matter) as pacing (as opposed to trotting or gliding). Knowledge about the diffusion mode allows us to draw conclusions on the relevance of tunneling to the surface diffusion of polyatomic organic molecules.

Why bother? The class of molecules investigated here can transport themselves and molecular cargo on an unpatterned surface in a predictable fashion. Directed transport of molecules is fundamental to life: for instance, kinesin motor proteins transport vesicles and organelles to their point of deployment inside a cell.

Fermi surfaces.
High temperature superconductors is highly anisotropic. The Fermi surface is very close to the Fermi surface of the doped CuO2 plane (or multi-planes, in case of multi-layer cuprates) and can be presented on the 2D reciprocal space (or momentum space) of the CuO2 lattice. The typical Fermi surface within the first CuO2 Brillouin zone is sketched below.In a wide range of charge carrier concentration (doping level), in which the hole-doped superconductor, the Fermi surface is hole-like (i.e. open).



Solids with a large density of states at the Fermi level become unstable at low temperatures and tend to form ground states where the condensation energy comes from opening a gap at the Fermi surface. Examples of such ground states are superconductors, ferromagnets, Jahn-Teller distortions and spin density waves.

The state occupancy of fermions like electrons is governed by Fermi-Dirac statistics so at finite temperatures the Fermi surface is accordingly broadened. In principle all fermion energy level populations are bound by a Fermi surface
In condensed matter physics, the Fermi surface is an abstract boundary useful for predicting the thermal, electrical, magnetic, and optical properties of metals, semimetals, and doped semiconductors. The existence of a Fermi surface is a direct consequence of the Pauli exclusion principle. the particles fill up all energy levels till εF, which is equivalent to saying that εF is the energy level below which there are exactly N states.

In momentum space, these particles fill up a sphere of radius pF, the surface of which is called the Fermi surface.

The linear response of a metal to an electric, magnetic or thermal gradient is determined by the shape of the Fermi surface, because currents are due to changes in the occupancy of states near the Fermi energy. Free-electron Fermi surfaces are spheres determined by the valence electron concentration where \hbar is the reduced Planck's constant. When a material's Fermi level falls in a bandgap, there is no Fermi surface. As with the band structure itself, the Fermi surface can be displayed in an extended-zone scheme where \vec{k} is allowed to have arbitrarily large values or a reduced-zone scheme. Fermi surfaces have been measured through observation of the oscillation of transport properties in magnetic fields. The oscillations are periodic versus 1 / H and occur because of the quantization of energy levels in the plane perpendicular to a magnetic field, a phenomenon first predicted by Lev Landau. The new states are called Landau levels and are separated by an energy \hbar \omega_c where ωc = eH / m * c is called the cyclotron frequency, e is the electronic charge, m * is the electron effective mass and c is the speed of light.

With positron annihilation the two photons carry the momentum of the electron away; as the momentum of a thermalized positron is negligible, in this way also information about the momentum distribution can be obtained. Because the positron can be polarized, also the momentum distribution for the two spin states in magnetized materials can be obtained.




Update jan. 2014:
Mitochondrial transfer from stem cells to damaged cells to help them heal.Epithelial mitochondrial dysfunction is critical in asthma pathogenesis. Here we show for the first time that Miro1, a mitochondrial Rho‐GTPase, regulates intercellular mitochondrial movement from mesenchymal stem cells (MSC) to epithelial cells (EC). We demonstrate that overexpression of Miro1 in MSC (MSCmiroHi) leads to enhanced mitochondrial transfer and rescue of epithelial injury.






fredag 17 september 2010

Electronic senses act as police dogs?.

Why is Life depending on carbon and DNA?

Maybe a part of the answer is revealed in US? A new chemical sensor based on just two materials, graphene and DNA, has been unveiled. Scientists believe that it could be used to make an electronic "nose". The moleculeas are recognized electromagnetically, not chemically, as the 2004 Nobelprizewinner said, Linda Buck and Richard Axel. "Receptors are proteins that nestle in the cell's surface and bind specific chemicals in much the same way that a key fits into a lock. When activated by a chemical, receptors trigger molecular signals within a cell that alter the cell's metabolism. In the case of taste receptors, chemicals impinging on the taste buds trigger nerve impulses that travel to the brain, where taste information is processed. " I have earlier written about odor and perception.



Fig. Converting the current noise power density to current variation yields a best‐possible detection threshold of ~ 0.1% of the baseline current using a 1 Hz bandwidth. Assuming a linear response to DMMP concentration, this implies a detection limit of 0.4 ppm for a single device for DMMP.

Each sensor reacts to a specific molecule, just like the olfactory receptor proteins in mammal noses do. But to fabricate thousands of different sensors is expensive and complicated. Now a simple way of sensing chemicals by showing that the electronic properties of DNA-coated graphene change in when exposed to certain molecules.

Graphene is a two-dimensional material with exceptional electronic properties and enormous potential for applications. It is a sheet of carbon just one atom thick, made into a transistor. Each transistor was then soaked in a solution of a specific sequence of single-stranded DNA, which self-assembles into a pattern on the surface of the graphene. DNA is made from four different bases – adenine (A); cytosine (C), thymine (T); and guanine (G) – and an example of a sequence used is GAG TCT GTG GAG GAG GTA GTC. "We only tested a few sequences but the number of possible sequences is essentially endless." The researchers selected their DNA sequences based on the ability of the sequence to work as a chemical sensitizing agent – a role very different from the function of DNA in living organisms. Each sequence behaves a little differently on the surface of graphene because it has a different shape, pH and hydrophilic properties.

This means that every sequence interacts differently with different volatile organic chemicals (VOCs).

The chemical sensors consisting of a single-walled carbon nanotube field effect transistor (swCN-FET) with a nanoscale layer of single stranded DNA (ssDNA) adsorbed to the tube's outerwall. The current through the swCN-FET shows a characteristic response to gaseous analytes. This response varies depending on the base sequence of the adsorbed ssDNA. These sensors have been able to detect methanol, trimethylamine, propionic acid, dimethyl methylphosphonate (a simulant of sarin), and dinitrotoluene (a derivative of TNT) at the ppm level. The response and recovery of this biosensor is on the order of seconds.

When the DNA/graphene reacts with a chemical in its environment, the resistance of graphene changes. This change, which can be as large as 50%, can easily be measured.

Electronic noses can maybe make the security jobs like dogs do.


References
DNA-decorated graphene chemical sensors. Ye Lu, B. R. Goldsmith, N. J. Kybert and A. T. C. Johnson. Appl. Phys. Lett. 97, 083107 (2010); doi:10.1063/1.3483128
http://arxiv.org/abs/1008.3540
DNA-decorated Carbon Nanotubes for Chemical Sensing, C. Staii, M. Chen, A. Gelperin, and A.T. Johnson, Nano Lett. 2005, 5, 1774-1778

http://physicsworld.com/cws/article/news/43643
Johnson Group, http://www.lrsm.upenn.edu/~nanophys/biosensors.html

"The Nobel Prize in Physiology or Medicine 2004". Nobelprize.org. 17 Sep 2010 http://nobelprize.org/nobel_prizes/medicine/laureates/2004/

söndag 12 september 2010

A shining cage.

This is from a comment of mine on the viXra blog.

I have worked hard against the plans for building of new nuclear plants in Finland. In my mind it is pure madness. This question is also about energy, but of a completely different kind, manmade energy. Can manmade energy be linked to the Universal energy balance? Maybe? If we can get energy from our magnetic field around Earth. Or from Sun. This energy is always only a loan.

Tonight was a documentar on TV about ‘the final solution’, a ‘shining cage’ underground, named Onkalo. The documentar really put this question into frames of such an caliber that it make you freeze.

Why is this nuclear power used? To get energy. If say Chinese and India want the same living standard as us say after 20 years there need to be built three new nukes EVERY DAY. This will guarantee energy for these states in another 20 year. Why not longer? Because then the uranium is depleted, only sources with too low levels to use are left. I know the nuclear industry claims otherwise, but there is no facts today supporting them.

Nuclear power is claimed to diminish the greenhouse climate, but in reality it is about the same bad waste as coal, say some experts, because uranium mining need so much energy. So this argument fails.

Put in a time-frame this little advantage seems very ridiculous. Nuclear waste is dangerous in 100000 years. If we look back this is when the humans went out of Africa. Neanderthals was extinct about 40000 y ago. The pyramids was built 4000 y ago. If we divide 100000 y in 10 we get 10 periods as long as the whole human civilization from when humans began to use simple tools.

There is no way to guarantee the waste safety for so long time. Best is to seal it underground and totally forget about it !!!!

But there must be built many life dangerous underground cities, many, many.

All this only because humans today want to live comfortable in a few years. For our comfort our children and their children etc. will live with life danger in eternal times. And we call this civilization.

Civilization is in my opinion something else, more long-lasting of a better kind. The only thing left from our civilization are those cages?

Thanks.

fredag 10 september 2010

Experiencies of God and loneliness.

I am afraid of being alone. I mean, totally alone, not anyone around you. I have come to hate loneliness. This is a result of my childhood and youth. I was always alone, I was silent, I was shy. Nobody wanted to be with me, not even to go by my side when the school was out walking. Nobody wanted to sit by my side, nobody wanted to play with me. Always I stood looking at the others when they had fun. Oh, I would have wanted to be playing too. To be together. Running, shouting, do small nasty things to each other. But I stood silent and looked away, nonexistent. Non-heard, non-seen.

I learned to pretend it didn't matter. I had my fantasies, daydreams. There I could run and shout. I learned to compensate by reading, I read everything that came in my way. I was good in school. The only thing the others wanted from me was answers to their questions. I knew all the answers. My parents said the teachers tried to 'propose'. It hurted me.

I had my first experience of 'the light' as a teenager. It was 'unity', everything was light, and it felt so sweet. This was 'God'. It lasted only for a short while, something disturbed my perceptions, and the contact was broken. This was an enormous experience. I never forget it. Now I knew there was something else, something unseen mostly. I could feel it.

Later in life I have experienced it too. And another feeling, like 'tickling', 'endearment', a plasma-like appearence of another being when I was near that person. A wise woman said it was the soul. Also this felt extremely good.

Another type of 'seeing' is to see different appearences, different ages, times. As if there is no real time, everything is a superposition. You only 'seem to' experience one of the time-sheets. You can just as well experience something else, another time.


What has this to do with God and loneliness? It is the superpositions, the Schrödinger cat. The cat is both living and dead at the same time. It is the superpositions that makes it living.

Emotions must be shared to fully experience them. Matti Pitkänen writes:
The birth of TGD is a holistic process taking place in the time span of 32 years involving all physics related things from Planck length scale to quantum biology to cosmology and therefore a diametric opposite of the usual scientific work in which one has a precisely defined problem and method and one can forget everything else in the Universe and be fully left-brained and extremely reductive, precise, and analytic. Therefore it is obvious that I will probably remain the only one who understands what TGD is in this left-brained scientific community. Despite this I am happy and proud albeit somewhat frustrated. Who wants to be a musician playing music which sounds heavenly in his own ears but whom no one bothers to listen? A lonely millionaire is not a happy millionaire.
This text has echoed in me for some time. Then I figured out what was so terrible with loneliness. There are no superpositions. Loneliness means very few superpositions in the Schrödinger cat analogy.

The worst possible punishment in ancient China was deportation outside the wall. In the Greek mythology is told of the different ages of man, how unhappy the only human surviving a catastrophy was, so unhappy she didn't want to live. Small babies that are unloved experience the same. etc.


I must have something to take care of to feel good. It is my privilege as a woman. It has nothing to do with control. It is a superposition.

To love someone is to flood that person, and the loved one must permit the flooding, I read somewhere. A superposition.

When we feel what another person want to say we do projections. We can also project our own feelings on another person. Superpositions again (mirror-neurons connect?).

It is these superpositions that are the most important things in our lives. It really is terrible to be alone.

But to experience God is fabulous. He is many superpositions at the same time? Many aspects of entanglement. It can easily be compared to intense love between humans. It doesn't require anything from you, only that light, white light everywhere. I think this is what the Initations is about, the enlightment. It is very literal. It is very highly addicting.

To make love resembles this a little. Todd Murphy has written about consciousness and sex, where spirituality is stronger. Once I had a dream, saying there must be one of each gender, so we can experience God :). We humans look down on animals having intercourse, when they are experiencing their God. It is well worth fighting for. Darwin was wrong, competition is a weaker force.

fredag 3 september 2010

Quantum biology - DNA

The Relevance Of Continuous Variable Entanglement In DNA June 28, 2010. ArXive blog.

Quantum entanglement helps prevent the molecules of life from breaking apart? Earlier I wrote of quantum photosynthesis, now the DNA-bondings. I quote:

There was a time, not so long ago, when biologists swore black and blue that quantum mechanics could play no role in the hot, wet systems of life. Since then, the discipline of quantum biology has emerged as one of the most exciting new fields in science. It's beginning to look as if quantum effects are crucial in a number of biological processes, such as photosynthesis and avian navigation which we've looked at here and here.

Now a group of physicists say that the weird laws of quantum mechanics may be more important for life than biologists could ever have imagined. Their new idea is that DNA is held together by quantum entanglement.


Entanglement is the weird quantum process in which a single wavefunction describes two separate objects. When this happens, these objects effectively share the same existence, no matter how far apart they might be.

The question that Elisabeth Rieper at the National University of Singapore and a couple of buddies have asked is what role might entanglement play in DNA. To find out, they've constructed a simplified theoretical model of DNA in which each nucleotide consists of a cloud of electrons around a central positive nucleus. This negative cloud can move relative to the nucleus, creating a dipole. And the movement of the cloud back and forth is a harmonic oscillator.

When the nucleotides bond to form a base, these clouds must oscillate in opposite directions to ensure the stability of the structure.

Rieper and co ask what happens to these oscillations, or phonons as physicists call them, when the base pairs are stacked in a double helix. Phonons are quantum objects, meaning they can exist in a superposition of states and become entangled.

To start with, Rieper and co imagine the helix without any effect from outside heat. "Clearly the chain of coupled harmonic oscillators is entangled at zero temperature," they say (T=0K). They then go on to show that the entanglement can also exist at room temperature.

That's possible because phonons have a wavelength which is similar in size to a DNA helix and this allows standing waves to form, a phenomenon known as phonon trapping. When this happens, the phonons cannot easily escape. A similar kind of phonon trapping is known to cause problems in silicon structures of the same size.

That would be of little significance if it had no overall effect on the helix. But the model developed by Rieper and co suggests that the effect is profound.

Although each nucleotide in a base pair is oscillating in opposite directions, this occurs as a superposition of states, so that the overall movement of the helix is zero. In a purely classical model, however, this cannot happen, in which case the helix would vibrate and shake itself apart.

So in this sense, these quantum effects are responsible for holding DNA together.

The question of course is how to prove this. They say that one line of evidence is that a purely classical analysis of the energy required to hold DNA together does not add up. However, their quantum model plugs the gap. That's interesting but they'll need to come up with something experimentally convincing to persuade biologists of these ideas.

One tantalising suggestion at the end of their paper is that the entanglement may have an influence on the way that information is read off a strand of DNA and that it may be possible to exploit this experimentally.

Speculative but potentially explosive work. Maybe the experimental proofs comes from things discussed at Gibbs and Keas bloggs? Keas hexagons are also interesting as a minute synapse model and receptor model in biology. I have long looked for something like that. Also TGD has much on DNA and quantum biology.