söndagen den 26:e september 2010

The informational problem - telomeres and loops.

Telomeres are end caps of the chromosomes, and essential for their function, stability and prevent gene amplification. Telomeres protect the normal ends of chromosomes from being recognized as deleterious DNA double-strand breaks (shelterin protects the ends). Correct telomere length setting is crucial for long-term survival. The telomere length reserve must be sufficient to avoid premature cellular senescence and the acceleration of age-related disease.

It is currently not understood how telomeres prevent DNA damage responses from causing permanent cell cycle arrest. Telomeres constitute a chromatin-privileged region of the chromosomes that lack essential epigenetic markers for DNA damage response amplification and cell cycle arrest, and checkpoint mediator exclusion in cell division is crucial, otherwise the DNA damage-repair system would initiate a checkpoint response and cause telomere – telomere fusions. Checkpoint kinases modulate chromatin structures near DNA breaks by phosphorylating a serine residue in the carboxy-terminal tail SQE motif of histone. Mutation of the histone genes caused sensitivity to a wide range of genotoxic agents, increased spontaneous DNA damage, and impaired checkpoint maintenance. Also striking synergistic interaction in ionizing radiation (IR) survival.

Most of the eukaryotic telomeric DNA is organized in tightly packed nucleosomes(an octameric core structure of histones with DNA wrapped around)which are separated by 10–20 bp of linker DNA. Several specific proteins contribute to the telomeric structure; however, the exact telomere organization is still unclear. Whereas the role played by telomeric proteins in telomere function and regulation has been widely investigated, little is known about the contribution of nucleosomes to the protection of chromosome ends.

A telomere is a region of repetitive DNA which defer the degradation of genes near the ends of chromosomes by allowing for the shortening of chromosome ends, which necessarily occurs during chromosome replication. Telomere length varies greatly between species, up to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. In general, one strand is rich in G with fewer Cs. These G-rich sequences can form four-stranded structures, G-quadruplexes, with sets of four bases held in plane and then stacked on top of each other with either a sodium or a potassium ion between the planar quadruplexes.

In human blood cells, the range of lengths of the telomeres varies between 8000 base pairs at birth, to 1,500 base pairs in the elderly. During cellular division, an average of 30 to 200 base pairs are removed from the ends of the telomeres. In normal cases, the cells of a human can divide between 50 to 70 times.

Fig. Structure of parallel quadruplexes that can be formed by human telomeric DNA. Telomerase also contains a piece of template RNA, the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In humans, this TERC telomere sequence is a hexameric repeating string of TTAGGG-end in the 3' direction, between 3 and 20 kilobases in length.

Replication, transcription, recombination and damage repair use similar structures.
DNA can adopt structures other than the Watson–Crick duplex when actively participating in replication, transcription, recombination and damage repair. Of particular interest are guanine-rich regions, which can adopt a four-stranded topology called the G-quadruplex. Such architectures are adopted in several key biological contexts, including DNA telomere ends, the purine-rich DNA strands of oncogenic promoter elements, and within RNA 5′-untranslated regions in close proximity to translation start sites.

Alternate DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by sequences that are widely distributed throughout the human genome. G-quadruplexes are built from the stacking of successive G–G–G–G tetrads (G-tetrads) and stabilized by bound monovalent Na+ and K+ cations . The G-tetrad is a cyclic hydrogen-bonded square planar alignment of four guanines, with the guanines adopting either anti or syn alignments about glycosidic bonds. G-quadruplexes are very stable, with their large diameter and four grooves defining a unique architecture different from the double helix.


Schematic pic. The backbone can adopt different directionalities.
a. Each guanine uses its Watson–Crick and major groove edges to form a pair of hydrogen bonds. This leaves the minor groove edge available for further recognition.
b. anti and (c) syn guanine glycosidic torsion angle alignments.
d. Two views of K+ cation-coordination between adjacent G-tetrad planes.


Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence that acts to protect the terminal ends of chromosomes. Telomerase is an unusual DNA polymerase, a reverse transcriptase that extends the single-stranded G-rich 3' protruding ends of chromosomes, stabilizes telomere length in germ line cells (between 1000 and 1700 copies of TTAGGG) and regenerative tissues as well as in tumor cells. When telomerase is present in the cell, its activity is tightly regulated at its site of action by factors specifically bound to the telomeric DNA. Recent data indicate that telomeres reorganize during the cell cycle. In humans, telomerase assembles with telomeres during S phase of the cell cycle.

Telomeres are dynamically organized and remodeled during cell cycle and stress response. This suggests a model in which telomeres switch between extendible and nonextendible states in a length-dependent manner, and a second switch between a non-telomerase-associated "extendible" and a telomerase-associated "extending" state.

The RNA problem.
These TTAGGG tandem repeats are attached to the 3'-ends of the DNA strands and are paired with the complementary sequence 3'-AATCCC-5' on the other DNA strand. Thus, a G-rich region is created at the 3'-end of each DNA strand and a C-rich region is created at the 5'-end of each DNA strand. Typically, at each end of the chromosome, the G-rich strand protrudes 12 to 16 nucleotides beyond its complementary C-rich strand.
The problem of how chromosomes could replicate right to the tip, as such was impossible with replication in a 5' to 3' direction. DNA polymerase can synthesize DNA in only a 5' to 3' direction only by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. DNA polymerase can use a previous stretch of DNA 5' to the RNA template as a template to backfill the sequence where the RNA primer was; at the terminal end of the chromosome, however, DNA polymerase cannot replace the RNA primer because there is no position 5' of the RNA primer where another primer can be placed. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome.


Model of telomere shortening and telomerase activity. Telomerase elongates the 3' ends of chromosomes.

The unique metabolism of G-rich chromosomal regions that potentially form quadruplexes may influence a number of biological processes including immunoglobulin gene rearrangements, promoter activation and telomere maintenance. A number of human diseases are characterized by telomere defects.

Cancers and lifestyle.

If cells divided without telomeres, they would lose the ends of their chromosomes, and the necessary information they contain. The telomeres are disposable buffers blocking the ends of the chromosomes and are consumed during cell division and replenished by an enzyme, the telomerase reverse transcriptase. This may be invoked on with life-style (2008, Dean Ornish - our genes are not our fate (video), they can be changed) et al.. Vitamin D may also slow the shortening of the telomer. Vitamin D is a potent inhibitor of the proinflammatory response. It may also be considered a hormone. We can increase telomerase-levels and switch on good genes or inhibit the telomer-eroding? Telomerase is ubiquitously expressed only during the first weeks of embryogenesis, and is subsequently downregulated (?) in most cell types in humans.
Oxidative stress and accumulating reactive oxygen species (ROS) lead to an increased telomere shortening due to a less efficient repair of SSB in telomeres.

Telomeres can be seen as natural double-strand breaks (DSB), specialized structures which prevent DSB repair and activation of DNA damage checkpoints. Telomerase is the natural enzyme which promotes telomere repair. It is however not active in most cells. It certainly is active though in stem cells, germ cells, hair follicles and (worryingly) in 90 percent of cancer cells. The more a cell divides the more prune to get a cancer. Sometimes a cancer cell is said to be 'degenerated' meaning a more primitive stage - more like a stem cell.

Telomeres act as a sort of time-delay "fuse" or "buffer", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions. Telomeres protect a cell's chromosomes from fusing with each other or rearranging (mutate) — abnormalities that can lead to cancer — and so, cells are destroyed when their telomeres are consumed (apoptosis).

Most cancers are the result of "immortal" (primitive) cells that have ways of evading this programmed death (apoptosis). Malignant cells that bypass this blocked celldivision and become immortalized by telomere extension due mostly to the activation of telomerase, the reverse transcriptase enzyme responsible for synthesis of telomeres. However, 5–10% of human cancers activate the Alternative Lengthening of Telomeres (ALT) pathway (mesenchymal origin), which relies on recombination-mediated elongation. In research they can activate the production of telomerase in cells that do not usually produce this enzyme.

Age and lifestyle.
Short telomeres trigger DNA damage checkpoints, which mediate cellular senescence.
Human somatic cells lacking telomerase gradually lose telomeric sequences, which involves p53 (detoxification, cytochrome-pathway, immunosystem) and pRb pathways (retinoblastoma protein, proliferation, cell cycle, immunoregulation) and leads to the arrest of cell proliferation (regulating progression through the mammalian cell cycle, suppression of emergence of cancer). High levels of the cyclin-dependent kinase inhibitor p16 mediate G1 arrest (and also cdc-proteins) in senescence, by regulation from phosphorylation. Alterations in other cell cycle regulatory genes also mediates senescence. All of these genes encode putative tumor suppressor proteins. Also RAS-cell lines are involved. Fibroblasts are also very important. Developement, tumors and proliferation are invoked on.

However, further cell proliferation can be achieved by inactivation of p53 and pRb pathways = expression of DNA tumor virus oncoproteins. Cells entering proliferation after inactivation of p53 and pRb pathways undergo crisis. Crisis is characterized by gross chromosomal rearrangements and genome instability, and almost all cells die. Rare cells emerge from crisis immortalized = cancerous.

Phosphorylation regulates pRb function and cytochrome function, but also the hormonal situation, inflammation, allergies, diseases of many kinds.
Inhibiting the expression of p53, either by antisense RNA methods or by use of p53 transdominant mutants, leads to a delay in senescence. Many people also have genetically slow function of p53, and are vulnerable to 'bad' lifestyle and medications.

The best way to prevent cancers are to promote the G1 phase of the cell cycle. This is done by a low caloric diet, as instance?

"In 90 percent of cancers, no matter what caused the cancer to form, it needs telomerase activity to maintain the cell. Without telomerase, the cell will die. Telomerase is kept in control by the protein TRF1, which keeps the telomeres operating correctly. TRF1 levels are regulated by ubiquitin-dependent proteolysis. Ubikinon is a growth-regulator that diminish with age.

The adrenal cortex undergoes significant age-related changes at the organ level. With age the zona reticularis disappears and dehydroepiandrosterone (DHEA) and dehydroepiandrosterone sulfate (DHEAS) production decreases and senescence may contribute to it, specifically in the self-renewing stem cell compartment. preservation of the vital functions of the outer zona glomerulosa (= mineralocorticoid production) and zona fasciculata (= glucocorticoid production) may be ensured at the expense of the less vital functions of the innermost zona reticularis (= DHEA production). Senescent cells may also influence the steroidogenic profile through secreted senescence-associated factors. Recent microarray analyses have shown a distinct gene expression profile associated with senescence.

Reactive oxygen species have been implicated in age-associated changes in other steroidogenic tissues, such as Leydig cells and one might speculate that free radicals emerging as intermediate products of the process of steroidogenesis contribute to telomere and DNA damage and, in turn, to aging of the adrenal cortex. Overall, it is an interesting theory that the process started by cellular aging (cellular senescence) spreads via organ aging (loss of zona reticularis) to the organismal endocrine level via ceasing DHEA production.


Phosphorylation of the androgen receptor (AR) by MAPK and AKT. Numerous signalling factors (intracellular and extracellular), involved in inducing cell growth and proliferation, stimulate the Ras pathway to activate MAPK. Subsequently, MAPK phosphorylates AR, enabling AR to form dimers, enhancing ARE (androgen response element) dependent gene expression. Similarly, intra- and extra-cellular factors inducing cell growth and migration and inhibiting cell adhesion activate the PI3 kinase pathway resulting in AKT dependent phosphorylation, dimerisation and activation of AR. Look at the complexity.

New evidence suggests that telomerase activation has an important role in normal somatic cells, and that failure to activate sufficient telomerase also promotes disease. The shortening of telomeres is linked to reduced lifespan, heart disease and osteoarthritis. Telomeres naturally shorten with age as cells divide, but also contract when cells experience oxidative damage linked to metabolism. Such damage is associated with cognitive problems like dementia.
Impairment of telomere integrity causes vascular dysfunction, which is prevented by the activation of telomerase. Mice with short telomeres develop hypertension and exhibit impaired neovascularization. Short telomeres have also been reported in the leukocytes of patients with cardiovascular disease or various cardiovascular risk factors. Also infection from Trypanosoma use epigenetic pathways.

The rate of telomere shortening as cells divide varies between different telomeres. This variation is between 50 to 150 base pairs per cell division. It is worth noting that the telomeres that are shorter initially. For example in humans the 17p telomere, are not necessarily the ones to be destroyed first!

Despite all of the above outlined observations, it is a statement of fact that the mean telomere length of a species does not always relate to the longevity of that species. Of all studied primates, humans seem to have both the shortest telomeres and the longest lifespan!

So, this effect is not genetic?


Schematic fig. for DNA damage response at dysfunctional telomeres. Shelterin subunits protect telomeres.

Epigenesis and environment.
There is a huge reason for the intron to exist and for splicing to occur. DNA damage response can be considered a signaling transduction pathway where the DNA damage is detected by ‘sensors’. Recent studies have demonstrated that epigenetic modifications at telomeres have a profound effect on telomere length, and may also be linked to the ALT mechanism.
Telomeres are mainly formed by the entanglement of repeat DNA and telomeric and non-telomeric proteins, and are mainly seen as a 'mitotic clock'. Telomere lengths are heterogeneous because they differ among tissues, cells, and chromosome arms. Cell proliferation capacity, cellular environment, and epigenetic factors are some elements that affect this telomere heterogeneity. Also, genetic and environmental factors modulate the difference in telomere lengths between individuals. The understanding of telomere length dynamic in the normal population is essential to develop a deeper insight into the role of telomere function in pathological settings.
Chromatin modifications implicated in transcriptional regulation are thought to be the result of a code on the histone proteins (histone code). This code, involving phosphorylation, acetylation, methylation, ubiquitylation, and sumoylation of histones, is believed to regulate chromatin accessibility either by disrupting chromatin contacts or by recruiting non-histone proteins to chromatin. The histone code in which distinct histone tail-protein interactions promote engagement may be the deciding factor for choosing specific DSB repair pathways.

For example, cytosine methylation, a broad variety of histone post-translational modifications, and binding of non-coding RNAs determine the status of chromatin. A code that can be read by chromatin associating complexes, histones, determine the recruitment of effectors that regulate a specific biological process.

The histone code hypothesis.
Histone modifications are critical for the higher order organization of the DNA. The language of covalent histone modifications that correlate with transcription regulation was proposed and defined as the histone code in 2000 (Strahl & Allis, 2000; Turner, 2000).

1.Histone phosphorylation
by kinases has been associated with transcriptional regulation, DNA repair, and chromatin condensation, and has been shown by different laboratories to be linked to the ability of the cells to sense, respond, and repair (=recruiting repair proteins) lesions in DNA . Aurora kinases and mitogen and stress activated kinases have been shown to be responsible for phosphorylation of serine (compaction of chromatin during mitosis ).
Chiral proteins are important for the phospholylation. Chromatin structure needs to return to the original state and the DNA damage response signal to be turned off once the DNA break has been repaired. Phosphatases are required for the removal of ionizing radiation (IR) induced foci and for efficient recovery from DNA damage.

2.
Histone phosphorylation is followed or accompanied by acetylation of the histone residues for evacuation of histone variants from the damage site. The major purpose of acetylation is to induce decondensation of chromatin. Acetylation neutralizes the positive charge of lysine residues decreasing their interaction with negatively charged DNA. Overall, acetylation of lysine residues on histones is associated with transcriptional activation and DNA repair and has to be followed by deacetylation, allows the acquisition of a closed chromatin state.

3. Methylation
of lysine residues has been linked to the detection and repair of DNA DSBs. Dimethylated histone has a conserved role in the recruitment of factors participating in the repair of DNA damage. Trimethylation occur in thymus tissue upon whole-body exposure to irradiation. Impact on telomere metabolism?
As yet, it is not clear whether methylation of histones affects the overall charge of the nucleosomes like acetylation, but methylation of histones does provide sites for binding of chromatin-associating activities. Thus, it seems that such modifications may have a role. Recent studies have shown that DNA damage influences the chromatin associated movement of a non-histone chromatin modifying factor.

4. Ubiquitylation and sumoylation.
Ubiquitin and SUMO are bulky signaling modules that are expected to induce dramatic changes in the structure of chromatin. Histones are the most abundant ubiquitylated proteins that are not targeted for degradation as are other ubiquitylated proteins. In fact, ubiquitylation of histones plays a key role in transcriptional activation and repression, heterochromatic silencing, and DNA repair. SUMO is a small ubiquitin-related molecule of approximately 100 amino acids that modifies proteins. Histone sumoylation has been shown to mediate gene silencing in mammalian cells.

Epigenetic silencing of telomerase and a non-alkylating agent as a novel therapeutic approach talk of therapeutics that inhibits DNA methyltransferase and subsequently induces the expression of genes silenced by methylation, used against gliomas.


Loops, loops everywhere.
Loops in G-quadruplexes are linkers connecting G-rich tracts that support the stacked G-tetrad core. The loops can be classified into four major families that depend in part on the size and sequence of the linkers; lateral, diagonal, double-chain propeller (gives pentos or hexos) and V-shaped loops. Loop conformations stabilize and can adopt diverse topologies making them attractive targets for small molecule-based ligand recognition. The G-quadruplex topology is defined by four grooves whose dimensions (depth and width) and accessibility vary based on both the overall topology and whether the loops are edge-wise or diagonal on one hand, and double-chain-reversal on the other. Cations in the center (prefer K+ over Na+) neutralize the strong electrostatic potential associated with the inwardly pointing guanine O6 oxygen.
No folding rules - each new guanine-rich telomeric and oncogenic promoter must be researced for structure - conformational heterogeneity.

The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle stabilized by telomere-binding proteins. At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop. ALT cells produce abundant t-circles, possible products of intratelomeric recombination and t-loop resolution.

What is the functions of these loops? Strong electromagnetism included? They are sensitive to radiation. Studies have demonstrated the ability of the CTG/CAG and CGG/CCG tracts to form thermodynamically stable self-complementary hairpin structures and tetraplexes. Hairpins assembled from CTG oligomers form very stable antiparallel duplexes with TT pairs, whereas CAG oligonucleotides produce much less stable conformations which are destabilized by AA mispairs. This gives rise to unequal structural properties of repeated DNA during processes where single-stranded regions are involved, i.e., replication, transcription, repair or recombination. Hairpin structures will be formed and maintained more easily on the CTG strand than loops created on a strand containing CAG repeats.

Loops are seen also richly in the Y-chromosome (palindromic, the most prominent features here are eight massive palindromes, at least six of which contain testis genes.) and in the DNA polymerase signal recognition particle (SRP) is a ribonucleoprotein (protein-RNA complex), small RNA - much loops, important for the methionine, startcodon in the proteinsynthesis. Bacterias, plasmids and virus have often also many hairpin loops in their tRNA and HIV may be an example of that. An interesting question is whether the organization of the genome to chromosomes could have some deeper organizational meaning.

Introns are important for RNAs but most eukaryotic RNAs are processed after transcription. These processes include capping, polyadenylation, splicing, CCA turnover on the 3′ end of tRNAs, modification of base, sugar or phosphate moieties, etc.

In the case of human small RNAs it is known that several nucleotides are removed from the 3′ end of the primary transcript to generate mature RNA molecules, or a single adenylic acid residue is added; this nclude human SRP RNA. The signal recognition particle plays an important role in translocation of membrane proteins and secretory proteins. Human SRP RNA is transcribed by RNA polymerase III, and the 5′ and 3′ end portions of SRP RNA are over 80% homologous to the highly repeated Alu sequences in the primate genomes (evolutionary conserved).

The SRP consists of two distinct functional domains. The first one is the Alu domain that has a tRNA-like structure and plays an important role in arresting the elongation of nascent peptide in the ribosome.


A secondary structure of SRP RNA. Mammalian SRP RNA is 300-nucleotide-long, with sequence ex. (5′-pGATCTGATAGTGTCACCTAAATGAATTCA*-3′)
The second functional domain consists of the SRP RNA-specific S fragment and four SRP proteins. This domain is responsible for targeting the ribosome-nascent peptide chain complex to the surface of rough endoplasmic reticulum by interacting with SRP receptor. That is, very central for the synthesis.


The classical function of SRP in translation-translocation. A membrane separates the cytosol from the endoplasmic reticulum. A ribosome (light gray with A, P, and E sites) synthesizes a protein with a signal peptide (green) encoded by messenger RNA (indicated by a line with 5'- and 3-ends). The elongated SRP (blue), with its large (LD) and small (SD) domains, forms a complex which the membrane-resident SRP receptor (SR). When SRP separates, the protein crosses the membrane through a channel or translocon. The signal peptide may be removed by signal peptide peptidase (SP) and the protein modified by oligosaccharyl transferase (OT).


S-domain of human SPR. One or more SRP proteins bind to the SRP RNA to assemble the functional SRP.


Promoter gene.

Guanine-rich DNA sequences can form G-quadruplexes stabilized by stacked G-G-G-G tetrads in monovalent cation-containing solution. The length and number of individual G-tracts and the length and sequence context of linker residues define the diverse topologies adopted by G-quadruplexes. Unanticipated scaffolds such as interlocked G-quadruplexes, as well as novel topologies represented by double-chain-reversal and V-shaped loops, triads, mixed tetrads, adenine-mediated pentads and hexads and snap-back G-tetrad alignments common for oncogenic promoters and telomers, as well as a bimolecular G-quadruplex that targets HIV-1 integrase. Recent identification of guanine-rich sequences positioned adjacent to translation start sites in 5'-untranslated regions of RNA oncogenic sequences. The activity of the enzyme telomerase, which maintains telomere length, can be negatively regulated through G-quadruplex formation at telomeric endsthe energy concept,the ATP, role of the phosphate.

To be continued.

2 kommentarer:

  1. Ulla,

    a most excellent post- and one I am so grateful for the nuts and bolts under the theory- I find myself learning something new!

    I found and answered some comments on my blogspot (I did not set any spam filters on but had to undo them- one from Matti I am sorry I missed in our delayed communications that mess up the continuity of our dialog.

    I see connections from what we are all saying if we can pin it down- what is this quadraplex but topology of fourness along the lines of topological and string-like theories and yes, Dirac? And my more holonic way to see things (I have recent posts trying to describe how I see the dimensions now if we are to accept certain assumptions made by say Hawking- then other things logically follow or the theory lacks something essential.

    I think you might see that Rowlands showing there can be more than Crick and Watson may have some value?

    The PeSla

    SvaraRadera
  2. For me it is the link to our environmental clues that are the important ones. The genes are not entilrely dictating, but we can do much ourselves.

    Also the forms, why four corners in a hexameric 'string'. And what want the codons tell us? What happens to the magnetism and other forces? This is a global organization :) So many interesting bits of information find its place.

    The Genetics and Medicine has much to learn from Holistic Medicine :)

    In these 'strings' are no Dirac yet.

    SvaraRadera